Ancient DNA: Methods and Protocols (11 page)

4. DNA can be purifi ed from the digestion mixture in a number of different ways. Selecting a method depends ultimately on convenience and user preference. For small volumes, silica spin-columns are convenient, but for larger volumes these rapidly become very labour-intensive. For larger volumes of digestion mix (e.g., >1 mL), organic extractions are often preferable, in particular if large amounts of undigested melanin, dirt or 48

P.F. Campos and T.M.P. Gilbert

other material are present in solution, as these tend to block silica fi lters. For a silica protocol, r
efer to Subheading 3.3 . For

organic purifi cation, r
efer to Subheading 3.4
.

5. As recommended by Yang
et al.
( 6 )
, Qiagen’s “Qiaquick” PCR

cleanup kits are an excellent and quick tool for purifying DNA.

The instructions in the kit manual can be followed almost

directly if one replaces the phrase “PCR product” with “DNA extract”. The only change we recommend is the modifi cation of the centrifugal speeds.

6. Qiagen buffers contain guanidinium salts, and relevant local disposal regulations should be consulted.

7. The volume of EB to use in this step depends on fi nal concentration of DNA required and can be modifi ed.

8. Organic extractions use phenol and chloroform to help purify the DNA. Both phenol and chloroform are toxic, and phenol

in particular is extremely dangerous. Neither should be used without appropriate training. Always handle both liquids and their containers with extreme care, using appropriate face, hand, and body protection. Do not handle using latex gloves, as these are permeable to phenol and chloroform; use only

nitryl gloves. The fumes of both chemicals are dangerous;

therefore, these steps should always be performed in a vented fume hood. Disposal of both requires conformation to specifi c regulations, thus relevant local disposal regulations should be consulted.

9. Isopropanol precipitation is most effective at relatively high centrifugal forces and in small tubes (the DNA pellet is easiest to see and resuspend if 1.5-mL tubes or smaller are used).

If large volumes are to be precipitated, we recommend fi rst concentrating the liquid, for example with a centrifugal concentrator such as an Amicon centricon (Millipore, Billerica, MA) with 30 kD or less molecular weight cut-off.

10. Melanin pigments often copurify with the DNA and coprecipitate with the DNA during isopropanol precipitation. This results in a brown concentrated DNA pellet and a brown extract after resuspension. As melanin can inhibit enzymatic reactions (e.g., PCR), an additional purifi cation step may be followed, for example using a silica procedur
e (e.g., see Subheading 3.3
).

Acknowledgments

MTPG was supported by the Danish National Science Foundation’s “Skou” grant program.

6 DNA Extraction from Keratin and Chitin

49

References

1. Bonnichsen R, Hodges L, Ream W et al (2001)

genomes from extinct and extant rhinoceroses

Methods for the study of ancient hair: radiocar—

reveals lack of phylogenetic resolution. BMC

bon dates and gene sequences from individual

Evol Biol 9:95

hairs. J Archaeol Sci 28:775–785

5. King G, Gilbert M, Willerslev E et al (2009)

2. Gilbert M, Wilson A, Bunce M et al (2004)

Recovery of DNA from archaeological insect

Ancient mitochondrial DNA from hair. Curr

remains: fi rst results, problems and potential. J

Biol 14:463

Archaeol Sci 36:1179–1183

3. Rawlence N, Wood J, Armstrong K et al (2009)

6. Yang DY, Eng B, Waye JS et al (1998) Technical

DNA content and distribution in ancient feath—

note: improved DNA extraction from ancient

ers and potential to reconstruct the plumage of

bones using silica-based spin columns. Am J

extinct avian taxa. Proc Biol Sci 276:3395

Phys Anthropol 105:539–543

4. Willerslev E, Gilbert MT, Binladen J et al

(2009) Analysis of complete mitochondrial

sdfsdf

Case Study: Ancient Sloth DNA Recovered from Hairs

Preserved in Paleofeces*

Andrew A. Clack , Ross D.E. MacPhee , and Hendrik N. Poinar Abstract

Ancient hair, which has proved to be an excellent source of well-preserved ancient DNA, is often preserved in paleofeces. Here, we separate and wash hair shafts preserved in a paleofecal specimen believed to be from a Darwin’s ground sloth,
Mylodon darwinii
. After extracting DNA from the recovered and cleaned hair using a protocol optimized for DNA extraction from keratinous substrates, we amplify 12S and 16S

rDNA sequences from the DNA extract. As expected, the recovered sequences most closely match previously published sequences of
M. darwinii
. Our results demonstrate that hair preserved in paleofeces, even from temperate cave environments, is an effective source of ancient DNA.

Key words:
Ancient DNA , Coprolite , Hair , Paleofaeces , Sloth 1. Introduction

Preserved hair is known to be an excellent source of ancient DNA
( 1– 5 )
. DNA extracted from paleofeces has been used in taxonomic
analyses

( 6
)
,
dietary reconstr
uctions

( 7– 9 )
, and to identify the presence of taxa in environments where the fossil record is incom-

plete ( 9, 10
)
. Hair shafts in fecal samples ( 11,
12 )
may belong either to the defecator, to conspecifi c individuals as a result of grooming, or to prey. Ingested hair shafts can eventually be passed through the digestive tract, due to the durability of the keratinous exterior
( 1
) . Paleofeces may therefore represent an underutilized substrate for ancient hair that can be used for genetic research.

*
Note
: For the case study presented in this chapter, we describe DNA extraction and amplifi cation from ancient hairs preserved in paleofeces using a method similar to that presented in Chap. 6 .

Beth Shapiro and Michael Hofreiter (eds.),
Ancient DNA: Methods and Protocols
, Methods in Molecular Biology, vol. 840, DOI 10.1007/978-1-61779-516-9_7, © Springer Science+Business Media, LLC 2012

51

52

A.A. Clack
et al.

2. Materials

and Methods

A paleofecal sample attributed to
Mylodon darwinii
that contained hairs within its matrix was collected in 2001 from Cueva del Milodón in southern Chile and stored thereafter at the American Museum of Natural History (New York, NY). The specimen is estimated to be ~13,000 years old, which is in line with other specimens from this locality
( 13 )
. We extracted DNA from this specimen at the McMaster Ancient DNA Centre (Hamilton, ON, Canada), where modern and ancient processing facilities are spatially separated and sterile conditions are maintained to prevent contamination with modern DNA.

Using bleach and oven-sterilized tweezers, we removed six hair shafts of ~1–2 cm in length from the paleofecal sample. We washed the hairs in sterile H O three times to remove exterior debris. Using 2

fresh scalpel blades, we cut the hairs into equal length pieces of ~0.5 cm and placed them in a clean 2-mL tube. We then implemented an extraction protocol similar to that presented in Chap. 6

( 14
) . We added 1,200 m L of digestion buffer
( 1 )
to the tube containing the hair shafts, which we then incubated (along with a negative control) at 55°C. The hairs were fully digested after 10 h. We then added 500 m L of PCI (phenol/chloroform/isoamyl alcohol (25:24:1)) to the digested solution and shook the mixture gently for several minutes. We centrifuged the mixture at maximum speed for 5 min and transferred the aqueous phase to a new 2-mL tube.

We repeated the process using 500 m L of chloroform to remove residual phenol. We then concentrated and washed the aqueous extract layer (~1,000 m L).

We primed Microcon fi lter cartridges (Millipore, Canada) with 100 m L of laboratory-made 0.1× TE buffer and added either the sample or the blank to specifi c cartridges (in sequential steps of 500 m L until the entire sample had been passed through the fi lter).

We washed the fi lter membranes three times with 300 m L of 0.1×

TE. Finally, we added 100 m L of 0.1× TE to each cartridge, placed it in a new collection tube, and agitated the cartridge for 5 min at 1,000 rpm on the heat block at room temperature. Finally, we inverted the Microcon cartridges and centrifuged at 1,000 ×
g
for 3 min to collect the concentrated DNA. The fi nal extraction and blank were frozen overnight, thawed, and vortexed for 20 s before use.

We performed PCR in 20 m L reaction volumes, using 3 m L of undiluted extract/blank. All reagents were thoroughly thawed and vortexed for 20 s before use. Primers were designed by eye using the
M. darwinii
sequence published by Höss
et al.
( 13 )
(GenBank accession nos. Z48943 (12S) and Z48944 (16S)):

Md16SF 5 ¢ TAGGGATAACAGCGC-AATCC3 ¢ .

Md16SR 5 ¢ CGTAGGACTTTAATCGTTGA3 ¢ .

7 Case Study: Ancient Sloth DNA Recovered from Hairs Preserved in Paleofeces 53

Md12S 5 ¢ CTGGGATTAGATA-CCCCACTAT3 ¢ .

Md12SR 5 ¢ GTCGATTATAGGACAGGTTCCTCTA3 ¢ .

With primers, the target fragments were 147 and 152 bp long for the 12S and 16S fragments, respectively. PCR conditions were as follows: initial denaturation at 95°C for 5 min, 40 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 55°C, and extension at 72°C for 30 s, with a fi nal extension at 72°C for 10 min. Both fragments were PCR amplifi ed three times.

Following PCR, 4 m L of each amplifi cation product were loaded onto a 2.5% agarose gel stained with ethidium bromide, along with 1 m L of 100 bp DNA ladder. The gel was run in an electrophoresis chamber and separated products were visualized under UV light.

PCR products were cloned using a TOPO-TA cloning kit

(Invitrogen, Canada). Insert-carrying colonies were identifi ed and gently stabbed with a sterile 10-m L pipette tip to remove a small sample of bacteria. Each tip was soaked in 100 m L of sterile H O in 2

PCR strip tubes, which were then heated at 95°C for 5 min on a thermocycler to lyse the bacteria. We then amplifi ed the PCR inserts using M13 forward and reverse primers (provided in TOPO-TA cloning kits) and the previously described PCR and cycling profi le, using 2 m L of the lysed bacteria mix as DNA template. PCR products were purifi ed using AcroPrep 96 fi lter plates (Pall, USA), visualized on a gel, and approximately quantifi ed using the DNA ladder.

We sequenced the purifi ed and quantifi ed PCR products using the M13 forward primer as per manufacturer’s suggestions, with 1 m L of DNA, in 7 m L reactions, using 0.3 m L of BigDye ver1.1

(Applied Biosystems, Foster City, CA) and 1.5

m L buffer. We

cleaned the cycle sequencing products and sent the DNA to the MOBIX sequencing facilities on McMaster University campus

(Hamilton, ON, Canada) for sequencing. Finally, we visualized, aligned, and edited the resulting sequences and trace fi les using BioEdit (ver5.07)
( 15 )
.

3. Results

and Discussion

We obtained three independent PCR products each for fragments of the 12 and 16S rDNA genes. We cloned the products and

sequenced 12 and 9 clones for 12S and 16S, respectively. From these, we derived consensus sequences, both of which match the sequence for
M. darwinii
from Höss
et al.
( 13
)
(Figs. 1
and 2
), but differ from other sloth taxa. Within the clones, we observed 24 C

to T transitions and three G to A transitions. This type of sequence damage is likely the result of hydr
olytic deamination ( 16 )
and is
common in ancient specimens ( 16, 17
) . In this experiment, one 54

A.A. Clack
et al.

10

20

30

40

50

60

. . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

M.darwinii12S(Höss1996)

GCTTAGCCCTAAACCAAGACATTTGACAAACTAAAATGTTCGCCAGAGTACTACTAGCAA Mdhair12SPCR1Clone1

............................................................

Mdhair12SPCR1Clone2

............................................................

Mdhair12SPCR1Clone3

......T...........................................T.........

Mdhair12SPCR1Clone4

......T...........................................T.........

Mdhair12SPCR2Clone1

........................................T.........T.........

Mdhair12SPCR2Clone2

.......T..T.T.-.........A...................................

Mdhair12SPCR2Clone3

........................................T.........T.........

Mdhair12SPCR2Clone4

............................................................

Mdhair12SPCR3Clone1

.............T..............................................

Mdhair12SPCR3Clone2

..................................................T.........

Mdhair12SPCR3Clone3

............................................................

Mdhair12SPCR3Clone4

.............T..............................................

70

80

90

100

. . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . | . . . . |

M.darwinii12S(Höss1996)

CAGCCTAAAACTTAAAGGACTTGGCGGTGCTTCACACCCC

Mdhair12SPCR1Clone1

........................T...............

Mdhair12SPCR1Clone2

........................T...............